exon paper vocabulary stinks

Marie P.
92 words 1 learner

Learn words with Flashcards and other activities

Definition First极速168赛车 377936e02ce27ce724b98272ce20c0e0
Print Flashcards极速168赛车 902a441ff479f3adacbe4135eb3a3334

Other learning activities

Answer a few questions about each word. Use this to prep for your next quiz! Compete with other teams in real time to see who answers the most questions correctly! Test your spelling acumen. Read the definition, listen to the word and try spelling it!

Teaching tools

Create and assign quizzes to your students to test their vocabulary. Assign learning activities including Practice, Vocabulary Jams and Spelling Bees to your students, and monitor their progress in real-time.

Full list of words from this list:

words only definitions & notes
  1. myopathy
    any pathology of the muscles that is not attributable to nerve dysfunction
    DMD is a progressive
    and fatal X-linked myopathy arising from the absence
    of functional dystrophin at the myofiber plasma
    membrane.2
  2. intron
    sequence of a eukaryotic gene's DNA that is not translated into a protein
    Sequences were
    designed to target exonic sites of exon 6 (Ex6A) and exon 8
    (Ex8A), or exon/intron boundary between exon 6 and intron
    6 (Ex6B), or exon 8 and intron 8 (Ex8B) (see Fig 1).
  3. plasma membrane
    a thin membrane enclosing the cytoplasm of a cell
    DMD is a progressive
    and fatal X-linked myopathy arising from the absence
    of functional dystrophin at the myofiber plasma
    membrane    .2
  4. exon
    sequence of a gene's DNA that transcribes into protein structures
    A method to rescue dystrophin production by antisense oligonucleotides, termed exon-skipping, has been reported for
    the mdx mouse and in four DMD patients by local intramuscular injection.
  5. mRNA
    the template for protein synthesis
    Most DMD mutations are caused by outof-
    frame (frameshift) or nonsense gene mutations,
    whereas the majority of BMD mutations are in-frame,
    and thus compatible with production of a messenger
    RNA (mRNA) transcript that can be translated into a
    partly functional quasi-dystrophin (reading frame
    rule).3
  6. intramuscular
    within a muscle
    A method to rescue dystrophin production by antisense oligonucleotides, termed exon-skipping, has been reported for
    the mdx mouse and in four DMD patients by local intramuscular injection.
  7. point mutation
    a mutation due to an intramolecular reorganization of a gene
    The canine X-linked muscular dystrophy (CXMD)
    harbors a point mutation within the acceptor splice site
    of exon 7, leading to exclusion of exon 7 from the
    mRNA transcript.9
  8. thymidine
    a nucleoside component of DNA
    U (uracil) was used instead of T (thymidine)
    for the synthesis of 2O-MePs oligos.
  9. X-linked
    relating to genes or characteristics or conditions carried on the X chromosome
    DMD is a progressive
    and fatal X-linked myopathy arising from the absence
    of functional dystrophin at the myofiber plasma
    membrane.2
  10. in vivo
    in the living organism
    Methods: We tested a series of antisense drugs singly and as cocktails, both in primary cell culture, and two in vivo delivery
    methods (intramuscular injection and systemic intravenous injection).
  11. phenotype
    observable characteristics produced by genes and environment
    This raises the possibility of using
    antisense-mediated removal of exons carrying nonsense
    mutations, or whose presence disrupts the open reading
    frame at the site of the mutation, so as to restore the
    translational reading frame and thus to convert DMD
    to a milder BMD phenotype.5
  12. uracil
    a base containing nitrogen that is found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine
    U (uracil) was used instead of T (thymidine)
    for the synthesis of 2O-MePs oligos.
  13. muscular dystrophy
    any of several hereditary diseases of the muscular system characterized by weakness and wasting of skeletal muscles
    Objective: Duchenne muscular dystrophy (DMD) is caused by the inability to produce dystrophin protein at the myofiber
    membrane.
  14. messenger RNA
    the template for protein synthesis
    The efficiency and efficacy of multiexon skipping (exons
    6–9) were tested at the messenger RNA, protein, histological, and clinical levels.
  15. dystrophy
    any of several hereditary diseases of the muscular system characterized by weakness and wasting of skeletal muscles
    Objective: Duchenne muscular dystrophy (DMD) is caused by the inability to produce dystrophin protein at the myofiber
    membrane.
  16. systemic
    affecting an entire structure, network, or complex of parts
    Methods: We tested a series of antisense drugs singly and as cocktails, both in primary cell culture, and two in vivo delivery
    methods (intramuscular injection and systemic intravenous injection).
  17. translational
    of or relating to uniform movement without rotation
    This raises the possibility of using
    antisense-mediated removal of exons carrying nonsense
    mutations, or whose presence disrupts the open reading
    frame at the site of the mutation, so as to restore the
    translational reading frame and thus to convert DMD
    to a milder BMD phenotype.5
  18. intravenous
    within or by means of a vein
    We sought to test efficacy and toxicity of intravenous
    oligonucleotide (morpholino)-induced exon skipping in the DMD dog model.
  19. gene mutation
    a mutation due to an intramolecular reorganization of a gene
    Most DMD mutations are caused by outof-
    frame (frameshift) or nonsense gene mutations,
    whereas the majority of BMD mutations are in-frame,
    and thus compatible with production of a messenger
    RNA (mRNA) transcript that can be translated into a
    partly functional quasi-dystrophin (reading frame
    rule).3
  20. primary cell
    an electric cell that generates an electromotive force by an irreversible conversion of chemical to electrical energy; cannot be recharged
    Methods: We tested a series of antisense drugs singly and as cocktails, both in primary cell culture, and two in vivo delivery
    methods (intramuscular injection and systemic intravenous injection).
  21. kinase
    an enzyme that catalyzes the conversion of a proenzyme to an active enzyme
    Some BMD patients with deletions as large as
    33 exons (46% of the gene) can show little or no clinical
    symptoms, with only increased serum creatine kinase
    concentration.4
  22. mutation
    a change or alteration in form or qualities
    Ann Neurol 2009;65:667–676
    Duchenne muscular dystrophy (DMD) and its milder
    form, Becker muscular dystrophy (BMD), are caused
    by mutations in the DMD gene.1
  23. neurology
    the branch of medicine that deals with the nervous system
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  24. neuroscience
    the scientific study of the nervous system and the brain
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  25. neuromuscular
    affecting or characteristic of both nerves and muscles
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  26. toxicity
    the degree to which something is poisonous
    We sought to test efficacy and toxicity of intravenous
    oligonucleotide (morpholino)-induced exon skipping in the DMD dog model.
  27. functionality
    the capacity to be useful or serve a particular purpose well
    Use of cocktails of morpholino, as
    shown here, allows broader application of this approach to a greater proportion of DMD patients (90%) and also offers the
    prospect of selecting deletions that optimize the functionality of the dystrophin protein.
  28. amyotrophic lateral sclerosis
    thickening of tissue in the motor tracts of the lateral columns and anterior horns of the spinal cord; results in progressive muscle atrophy that starts in the limbs
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis     Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  29. creatine
    an amino acid that does not occur in proteins but is found in the muscle tissue of vertebrates both in the free form and as phosphocreatine; supplies energy for muscle contraction
    Some BMD patients with deletions as large as
    33 exons (46% of the gene) can show little or no clinical
    symptoms, with only increased serum creatine kinase
    concentration.4
  30. magnetic resonance imaging
    the use of nuclear magnetic resonance of protons to produce proton density images
    This was
    accompanied by reduced inflammatory signals examined by magnetic resonance imaging and histology, improved or stabilized
    timed running tests, and clinical symptoms.
  31. RNA
    a nucleic acid that helps synthesize proteins and transmit genetic data
    The efficiency and efficacy of multiexon skipping (exons
    6–9) were tested at the messenger RNA, protein, histological, and clinical levels.
  32. magnetic resonance
    resonance of electrons or atoms or molecules or nuclei to radiation frequencies as a result of space quantization in a magnetic field
    This was
    accompanied by reduced inflammatory signals examined by magnetic resonance imaging and histology, improved or stabilized
    timed running tests, and clinical symptoms.
  33. acceptor
    the person (or institution) who accepts a check or draft and becomes responsible for paying the party named in the draft when it matures
    The canine X-linked muscular dystrophy (CXMD)
    harbors a point mutation within the acceptor splice site
    of exon 7, leading to exclusion of exon 7 from the
    mRNA transcript.9
  34. histological
    of or relating to histology
    The efficiency and efficacy of multiexon skipping (exons
    6–9) were tested at the messenger RNA, protein, histological, and clinical levels.
  35. golden retriever
    an English breed having a long silky golden coat
    We used the Beagle model here,
    the mutation of which originates from the Golden Retriever
    model, but which is less severely affected.
  36. injection
    the forceful insertion of a substance under pressure
    A method to rescue dystrophin production by antisense oligonucleotides, termed exon-skipping, has been reported for
    the mdx mouse and in four DMD patients by local intramuscular injection.
  37. histology
    the study of the microscopic structure of tissues
    This was
    accompanied by reduced inflammatory signals examined by magnetic resonance imaging and histology, improved or stabilized
    timed running tests, and clinical symptoms.
  38. toxicology
    the scientific study of poisons
    DOI: 10.1002/ana.21627
    © 2009 American Neurological Association 667
    of performing toxicology tests and FDA approvals for
    each individual antisense sequence; a formidable barrier
    to clinical application.
  39. enhancer
    anything that serves by contrast to call attention to another thing's good qualities
    We determined these
    sites based on the exonic splicing enhancer motifs, GC contents,
    and secondary structures.
  40. methylated
    having received a methyl group
    Recently, intramuscular
    injection of 2O-methylated phosphorothioate (2OMePs)
    has been shown to induce limited dystrophin
    expression in four DMD boys.6
  41. psychiatry
    the diagnosis and treatment of mental disorders
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  42. clinical
    relating to or based on direct observation of patients
    The efficiency and efficacy of multiexon skipping (exons
    6–9) were tested at the messenger RNA, protein, histological, and clinical levels.
  43. in vitro
    in an artificial environment outside the living organism
    Previously,
    McClorey and colleagues10 showed transfection
    with antisense oligo targeting exons 6 and 8 restored
    reading frame of mRNA in cultured myotubes from
    dystrophic dogs in vitro.
  44. synthesize
    combine and form a complex whole
    Sequences were
    synthesized using two different backbone chemistries: 2OMePs
    (Eurogentec Lie`ge, Belgium), and morpholino
    (Gene-Tools, LLC Philomath, OR).12
  45. functional
    designed for or capable of a particular use
    DMD is a progressive
    and fatal X-linked myopathy arising from the absence
    of functional dystrophin at the myofiber plasma
    membrane.2
  46. protein
    an organic compound essential to living cells
    Objective: Duchenne muscular dystrophy (DMD) is caused by the inability to produce dystrophin protein at the myofiber
    membrane.
  47. splice
    join the ends of
    The canine X-linked muscular dystrophy (CXMD)
    harbors a point mutation within the acceptor splice site
    of exon 7, leading to exclusion of exon 7 from the
    mRNA transcript.9
  48. muscular
    having a robust body-build
    Objective: Duchenne muscular dystrophy (DMD) is caused by the inability to produce dystrophin protein at the myofiber
    membrane.
  49. sclerosis
    any pathological hardening or thickening of tissue
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  50. therapy
    the act of providing treatment for an illness or disorder
    Interpretation: This is the first report of widespread rescue of dystrophin expression to therapeutic levels in the dog model of
    DMD. This study also provides a proof of concept for systemic multiexon-skipping therapy.
  51. blood test
    a serologic analysis of a sample of blood
    Blood tests indicated no evidence of toxicity.
  52. molecular
    relating to the simplest units of an element or compound
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  53. gene
    part of DNA controlling physical characteristics and growth
    Ann Neurol 2009;65:667–676
    Duchenne muscular dystrophy (DMD) and its milder
    form, Becker muscular dystrophy (BMD), are caused
    by mutations in the DMD gene.1
  54. retriever
    a dog bred to help hunters recover game
    We used the Beagle model here,
    the mutation of which originates from the Golden Retriever
    model, but which is less severely affected.
  55. imaging
    the ability to form mental images of things or events
    This was
    accompanied by reduced inflammatory signals examined by magnetic resonance imaging and histology, improved or stabilized
    timed running tests, and clinical symptoms.
  56. transcript
    a written record of dictated or recorded speech
    Most DMD mutations are caused by outof-
    frame (frameshift) or nonsense gene mutations,
    whereas the majority of BMD mutations are in-frame,
    and thus compatible with production of a messenger
    RNA (mRNA) transcript that can be translated into a
    partly functional quasi-dystrophin (reading frame
    rule).3
  57. genetic
    relating to the study of heredity and variation in organisms
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  58. e-mail
    (computer science) a system of world-wide electronic communication in which a computer user can compose a message at one terminal that can be regenerated at the recipient's terminal when the recipient logs in
    E-mail: [email protected] or Dr. Takeda, Department of
    Molecular Therapy National Institute of Neuroscience, National
    Center of Neurology and Psychiatry 4-1-1 Ogawa-higashi, Kodaiva,
    Tokyo, Japan.
  59. plasma
    the watery fluid in which blood cells are suspended
    DMD is a progressive
    and fatal X-linked myopathy arising from the absence
    of functional dystrophin at the myofiber plasma
    membrane.2
  60. membrane
    a sheet of tissue that lines or connects organs or cells
    Objective: Duchenne muscular dystrophy (DMD) is caused by the inability to produce dystrophin protein at the myofiber
    membrane.
  61. beagle
    a small short-legged smooth-coated breed of hound
    We used the Beagle model here,
    the mutation of which originates from the Golden Retriever
    model, but which is less severely affected.
  62. mediate
    act between parties with a view to reconciling differences
    This raises the possibility of using
    antisense-mediated removal of exons carrying nonsense
    mutations, or whose presence disrupts the open reading
    frame at the site of the mutation, so as to restore the
    translational reading frame and thus to convert DMD
    to a milder BMD phenotype.5
  63. motif
    a recurrent element in a literary or artistic work
    We determined these
    sites based on the exonic splicing enhancer motifs, GC contents,
    and secondary structures.
  64. resonance
    the characteristic of having a loud deep sound
    This was
    accompanied by reduced inflammatory signals examined by magnetic resonance imaging and histology, improved or stabilized
    timed running tests, and clinical symptoms.
  65. synthesis
    the combination of ideas into a complex whole
    U (uracil) was used instead of T (thymidine)
    for the synthesis of 2O-MePs oligos.
  66. canine
    a dog, wolf, jackal, or other closely related mammal
    The canine X-linked muscular dystrophy (CXMD)
    harbors a point mutation within the acceptor splice site
    of exon 7, leading to exclusion of exon 7 from the
    mRNA transcript.9
  67. chemistry
    the science of matter
    Antisense Sequences and Chemistries
    We designed four antisense sequences to target exons 6
    and 8 of the dog dystrophin mRNA as follows: Ex6A
    (GTTGATTGTCGGACCCAGCTCAGG), Ex6B (ACCTATGACTGTGGATGAGAGCGTT),
    Ex8A (CTTCCTGGATGGCTTCAATGCTCAC),
    and Ex8B (ACCTGTTGAGAATAGTGCATTTGAT).
  68. inflammatory
    inciting action or rebellion
    This was
    accompanied by reduced inflammatory signals examined by magnetic resonance imaging and histology, improved or stabilized
    timed running tests, and clinical symptoms.
  69. serum
    an amber, watery fluid, rich in proteins, that separates out when blood coagulates
    Some BMD patients with deletions as large as
    33 exons (46% of the gene) can show little or no clinical
    symptoms, with only increased serum creatine kinase
    concentration.4
  70. toxic
    of or relating to or caused by a poison
    Here, we identified a phosphorodiamidate
    morpholino oligomer (PMO) cocktail
    that, using either intramuscular injection or systemic
    intravenous delivery, was not toxic, resulted in extensive
    dystrophin expression to therapeutic levels, and
    was associated with significant functional stabilization
    in dystrophic dogs in vivo.
  71. compatible
    able to exist and perform in harmonious combination
    Most DMD mutations are caused by outof-
    frame (frameshift) or nonsense gene mutations,
    whereas the majority of BMD mutations are in-frame,
    and thus compatible with production of a messenger
    RNA (mRNA) transcript that can be translated into a
    partly functional quasi-dystrophin (reading frame
    rule).3
  72. lateral
    situated at or extending to the side
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  73. biology
    the science that studies living organisms
    Address correspondence to Dr Hoffman, Research Center for Genetic
    Medicine, Children’s National Medical Center, Department of
    Integrative Systems Biology, George Washington University School
    of Medicine, 111 Michigan Avenue NW, Washington, DC 20010.
  74. backbone
    the series of vertebrae forming the axis of the skeleton and protecting the spinal cord
    Sequences were
    synthesized using two different backbone chemistries: 2OMePs
    (Eurogentec Lie`ge, Belgium), and morpholino
    (Gene-Tools, LLC Philomath, OR).12
  75. medicine
    the profession devoted to alleviating diseases and injuries
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  76. multiple
    having or involving more than one part or entity
    The ability to use cocktails of antisense
    oligonucleotides targeting multiple exons would
    permit design of quasi-dystrophin proteins that retain
    more functionality,7 Finally, the use of cocktails could
    lead to FDA-approved mixtures that would successfully
    treat a large group of DMD patients with distinct but
    overlapping deletions.
  77. medical
    relating to the study or practice of medicine
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  78. magnetic
    of or relating to or caused by attraction for iron
    This was
    accompanied by reduced inflammatory signals examined by magnetic resonance imaging and histology, improved or stabilized
    timed running tests, and clinical symptoms.
  79. laboratory
    a workplace for the conduct of scientific research
    This might alleviate the problem
    From the 1Research Center for Genetic Medicine, Children’s National
    Medical Center, Washington, DC; 2McColl-Lockwood Laboratory
    for Muscular Dystrophy Research, Neuromuscular/Amyotrophic
    Lateral Sclerosis Center, Carolinas Medical Center,
    Charlotte, NC; and 3Department of Molecular Therapy, National
    Institute of Neuroscience, National Center of Neurology and Psychiatry,
    Kodaira, Tokyo, Japan.
  80. correspondence
    an attribute of a shape or relation
    Address correspondence to Dr Hoffman, Research Center for Genetic
    Medicine, Children’s National Medical Center, Department of
    Integrative Systems Biology, George Washington University School
    of Medicine, 111 Michigan Avenue NW, Washington, DC 20010.
  81. normal
    being approximately average or within certain limits
    Results: Weekly or biweekly systemic intravenous injections with a three-morpholino cocktail over the course of 5 to 22 weeks
    induced therapeutic levels of dystrophin expression throughout the body, with an average of about 26% normal levels.
  82. drug
    a substance that is used as a medicine or narcotic
    Methods: We tested a series of antisense drugs singly and as cocktails, both in primary cell culture, and two in vivo delivery
    methods (intramuscular injection and systemic intravenous injection).
  83. cell
    the basic structural and functional unit of all organisms
    Methods: We tested a series of antisense drugs singly and as cocktails, both in primary cell culture, and two in vivo delivery
    methods (intramuscular injection and systemic intravenous injection).
  84. proportion
    relation with respect to comparative quantity or magnitude
    Use of cocktails of morpholino, as
    shown here, allows broader application of this approach to a greater proportion of DMD patients (90%) and also offers the
    prospect of selecting deletions that optimize the functionality of the dystrophin protein.
  85. average
    an intermediate scale value regarded as normal or usual
    Results: Weekly or biweekly systemic intravenous injections with a three-morpholino cocktail over the course of 5 to 22 weeks
    induced therapeutic levels of dystrophin expression throughout the body, with an average of about 26% normal levels.
  86. series
    similar things placed in order or one after another
    Methods: We tested a series of antisense drugs singly and as cocktails, both in primary cell culture, and two in vivo delivery
    methods (intramuscular injection and systemic intravenous injection).
  87. aliquot
    signifying an exact divisor or factor of a quantity
  88. aesthetics
    the branch of philosophy dealing with beauty and taste
  89. credal
    of or relating to a creed
  90. creed
    any system of principles or beliefs
  91. immanence
    the state of being within or not going beyond a given domain
  92. quotidian
    found in the ordinary course of events
Created on 九月 3, 2010 (updated 二月 12, 2012)

Sign up now (it’s free!)

Whether you’re a teacher or a learner 全国统一开奖网址, soonshin.com can put you or your class on the path to systematic vocabulary improvement.